Mutations In Myeloproliferative Neoplasms Research Articles

Lysosomal degradation targets mutant calreticulin and the thrombopoietin receptor in myeloproliferative neoplasms

AbstractSomatic mutants of calreticulin (CRT) drive myeloproliferative neoplasms (MPNs) via binding to the thrombopoietin receptor (MPL) and aberrant activation of the JAK/STAT pathway. Compared with healthy donors, platelets from patients with MPN and CRT mutations display low cell surface MPL. Additionally, coexpression of MPL with an MPN–linked CRT mutant (CRTDel52) reduced cell surface MPL, suggesting that CRTDel52 may induce MPL degradation. We showed that lysosomal degradation is relevant to the turnover of CRTDel52 and MPL. Furthermore, CRTDel52 increased the lysosomal localization and degradation of MPL. Mammalian target of rapamycin (mTOR) inhibitors reduced cellular CRTDel52 and MPL, secreted CRTDel52 levels, and impaired CRTDel52–mediated cell proliferation. mTOR inhibition also reduces colony formation and differentiation of CD34+ cells from patients with MPN but not from healthy donors. Together, these findings indicate that low-surface MPL is a biomarker of mutant CRT-mediated MPN and induces the degradation of CRTDel52 and MPL as an avenue for therapeutic intervention.

Sailing in deceptive calm: Navigating the undercurrents of essential thrombocythaemia.

The discovery of driver mutations in myeloproliferative neoplasms has significantly contributed to the management of patients with essential thrombocythaemia (ET). High-quality evidence has started to pave the way for targeted therapy. The review by Ferrer-Marín etal. further advances this discussion, highlighting how molecular profiling, including non-driver gene mutations, is set to revolutionize personalized treatment approaches for ET patients. Commentary on: Ferrer-Marín etal. Essential thrombocythemia: a contemporary approach with new drugs on the horizon. Br J Haematol 2024 (Online ahead of print). doi: 10.1111/bjh.19403.

Abstract 7295: A novel XNA technology-based assay to detect JAK2 V617F mutation by real-time PCR

Abstract The Janus kinase 2 (JAK2) gene is located on chromosome 9p24.1 and encodes a non-receptor tyrosine kinase that plays a central role in cytokine and growth factor signaling. The JAK2 protein is especially important for controlling the production of blood cells from hematopoietic stem cells. In fact, the JAK2 mutation at amino acid 617 (Valine 617 to Phenylalanine, V617F) is the most frequently detected mutation in myeloproliferative neoplasms (MPN), including essential thrombocythemia (ET), polycythemia vera (PV), and primary myelofibrosis (PMF). This dominant gain-of-function V617F mutation results in constitutive tyrosine phosphorylation activity, leading to uncontrolled blood cell production, including increased numbers of erythrocytes, neutrophils, and platelets. To detect the JAK2 V617F mutation in DNA from patient blood samples, we developed a unique real-time PCR assay using our proprietary XNA technology that enables the assay to selectively amplify the mutant sequence by using a synthetic DNA analog XNA (Xenonucleic Acid). The JAK2 V617F mutation detection assay is designed to detect a valine-to-phenylalanine mutation at amino acid 617 (V617F). PCR primers, TaqMan probes, and XNA were designed for the JAK2 V617F mutation, along with primers and probes for an internal control gene in the duplex setting. The analytical performance of the assay was verified and validated using a variety of control samples. The results revealed that the XNA completely suppressed the amplification of wildtype sequence while only the V617F mutant sequence was amplified. The JAK2 V617F mutation detection assay is highly reproducible with intra- and inter-assay coefficients of variation of less than 10%. Results for the assay’s analytical sensitivity indicated that V617F could be detected with about 0.25% mutant allele frequency in 10 ng DNA input. In addition, no significant cross-amplification between V617F and V617I was observed. Thus, the JAK2 V617F mutation detection assay is specific for the V617F mutation. The JAK2 V617F mutation detection assay, using XNA-based technology, provides high sensitivity and specificity to detect the JAK2 V617F mutation. Thus, this assay would be a useful tool for clinical decision-making in determining the presence of the JAK2 V617F mutation in DNA from patient blood samples. Citation Format: Shuo Shen, Robert Brown, Daniel Kim, Larry Pastor, Andrew Y. Fu, Pushpinder Kaur, Alisha Babu, Wei Liu, Aiguo Zhang, Hiromi Tanaka, Michael Y. Sha. A novel XNA technology-based assay to detect JAK2 V617F mutation by real-time PCR [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 7295.

JAK2V617F drives gut microbiota differences in patients with myeloproliferative neoplasms.

Essential thrombocythemia (ET), polycythemia vera (PV), and primary myelofibrosis (MF) are myeloproliferative neoplasms (MPN). Inflammation is involved in the initiation, progression, and symptomology of the diseases. The gut microbiota impacts the immune system, infection control, and steady-state hematopoiesis. We analyzed the gut microbiota of 227 MPN patients and healthy controls (HCs) using next-generation sequencing. We expanded our previous results in PV and ET patients with additional PV, pre-MF, and MF patients which allowed us to compare MPN patients collectively, MPN sub-diagnoses, and MPN mutations (separately and combined) vs. HCs (N = 42) and compare within MPN sub-diagnoses and MPN mutation. MPN patients had a higher observed richness (median, 245 [range, 49-659]) compared with HCs (191.5 [range, 111-300; p = .003]) and a lower relative abundance of taxa within the Firmicutes phylum; for example, Faecalibacterium (6% vs. 14%, p < .001). The microbiota of CALR-positive patients (N = 30) resembled that of HCs more than that of patients with JAK2V617F (N = 177). In JAK2V617F-positive patients, only minor differences in the gut microbiota were observed between MPN sub-diagnoses, illustrating the importance of this mutation. The gut microbiota in MPN patients differs from HCs and is driven by JAK2V617F, whereas the gut microbiota in CALR patients resembles HCs more.

Mutations in the RNA Splicing Factors U2AF1 and SRSF2 are Context-Dependent in Myeloproliferative Neoplasms

RNA splicing factor gene mutations are recurrently found in BCR::ABL1 negative myeloproliferative neoplasms (MPN). To understand the interactions between spliceosome gene mutations and MPN phenotypic driver mutations ( JAK2, CALR and MPL), we investigated their patterns of co-occurrence or mutual exclusivity in a cohort of 990 MPN patients with comprehensive molecular profiling and clinical information from the Hematologic Malignancies Data Repository (HMDR). As expected, MPN driver mutations ( JAK2, CALR and MPL) were mutually exclusive (N=658, N=168, N=53 respectively, Log2 OR≤-3.5 and Padj. ≤0.005 using pairwise Fisher's exact tests with Benjamin Hochberg multiple testing correction). Additionally, cases with co-occurring mutations in two RNA splicing factors, SF3B1, U2AF1 and SRSF2 (N=44, N=49, N=44) respectively were uncommon (2/135 splicing factor mutated cases) . We further found that U2AF1 and SRSF2 mutations co-occurred with JAK2 (log2 OR=1.7, Padj.=0.009) and MPL (log2 OR=2.1, Padj.=0.006) respectively, but rarely with CALR mutations (N=2 CALR-U2AF1 log2 OR=-2.3 Padj.=0.025, N=2 CALR-SRSF2 log2 OR=-2.2 Padj.=0.048). In contrast, CALR-SF3B1 mutations occurred at the expected frequency (Padj.=0.11). To explore the molecular settings where these mutations co-occur, we investigated the variant allele frequencies (VAFs) of CALR, U2AF1, SRSF2 and concomitant mutations in the CALR-U2AF1 (N=2) and CALR-SRSF2 (N=2) patients. The VAFs for the mutations detected in the first patient with CALR-U2AF1 co-mutation were: CALR 0.26, U2AF1 0.45, and TET2 0.41. Since CALR and splicing factor mutations are typically heterozygous, this suggests the CALR mutation was sub-clonal to the U2AF1 mutation and that U2AF1 and TET2 mutations were likely present in the same cell. In the second CALR-U2AF1 co-mutant case, VAFs were: CALR 0.31, U2AF1 0.27, and TP53 0.16. It is possible that in this case, the CALR and U2AF1 mutations may have occurred in independent clones or may have occurred in the same cell in the absence of other pathogenic mutations. For the two CALR-SRSF2 patients, data from three samples revealed VAFs of 0.23-0.46 for CALR and 0.21-0.58 for SRSF2 mutations. Considering their typical heterozygous occurrence, we inferred those individual cells harbored both CALR and SRSF2 mutations. Notably, in samples with high VAFs (&amp;gt;0.37) for both CALR and SRSF2 in two separate patients, additional high VAF pathogenic mutations were observed: 0.35 for ASXL1 and 0.46 for RUNX1 respectively. As ASXL1 and RUNX1 mutations also typically occur in a heterozygous manner, we hypothesized that when CALR and SRSF2 mutations are present in the same cell, another pathogenic co-mutation may be required for survival of the clone. To test our hypothesis, we FACS-sorted single lineage negative CD34 positive bone marrow cells from the first CALR- SRSF2 co-mutant case into 96 wells plates containing methylcellulose and hematopoietic growth factors (CFU-GEMM). DNA was harvested from single-cell colonies and genotyped for the following mutations using polymerase chain reaction (PCR) followed by gel electrophoresis and Sanger sequencing: CALR c.1154_1155insTTGTC p.K385fs*, SRSF2 c.284G&amp;gt;T p.P95H, ASXL1 c.1926_1927insG p.G642fs*, EZH2 c.2188_2212delAAAAAACAGCTCTTCGCCAGTCTGG p.F729fs*. Bulk NGS VAFs were 0.46, 0.38, 0.35, and 0.17, respectively. Out of 73 colonies analyzed, 71 colonies had the CALR insertion 5 mutation detected (see figure). Among these 71 CALR-mutated colonies, SRSF2 was found to co-occur in 35 colonies. Interestingly, all 35 colonies were accompanied by an ASXL1 mutation, and 29 of them had an additional EZH2 mutation. These findings support our hypothesis that CALR and SRSF2 mutations may co-occur in the same cell in the presence of another pathogenic mutation. Our findings offer molecular insights into the context-dependent behavior of splicing factor mutations in MPN. While they can co-occur with JAK2 and MPL mutations, U2AF1 and SRSF2 mutations are largely mutually exclusive with CALR mutations. In addition, our findings generate two main biological hypotheses: (i) a synthetic lethal relationship may exist between CALR mutations and SRSF2 or U2AF1 mutations, and (ii) this synthetic lethality may be overcome by the presence of additional pathogenic mutation(s) in the cell. Validation studies are ongoing to address these hypotheses. AM and AEM contributed equally.

Unlike TET2 and ASXL1, Co-Occurring DNMT3A Mutations Are Not Associated with Increased Age in JAK2-Mutant Myeloproliferative Neoplasms (MPNs)

MPNs including essential thrombocythemia (ET), polycythemia vera (PV), and myelofibrosis (MF) are characterized by JAK2, CALR and MPL mutations. Additional mutations outside these driver genes also co-occur. To better understand interactions between phenotypic driver mutations and concomitant mutations, we evaluated patterns of somatic mutation acquisition in 1301 MPN (535 ET, 392 PV, 331 MF, and 43 MPN NOS) patients who underwent clinical next generation sequencing (NGS) at our institution. For this analysis, we focused on a single NGS panel obtained closest to MPN diagnosis. Median age at MPN diagnosis was 59 years, with MF patients older than ET/PV patients (p&amp;lt;4e-11). 67%, 17%, and 4.5% of patients had mutations in JAK2, CALR, or MPL. The average variant allele fraction (VAF) for JAK2, CALR and MPL was 48%, 34%, and 40%. 52% of patients had pathogenic mutations in an additional gene (range 0-7), most frequently TET2, DNMT3A, and ASXL1. PV patients were more likely to have a TET2 mutation compared with JAK2-mutated ET patients (42% vs 25%). Mutation combinations that occurred together more frequently than expected (p&amp;lt;1e-3) included DNMTA-TET2, ASXL1-TET2, ASXL1-DNMT3A, and ASXL1-SRSF2. We then investigated how these concomitant mutations interacted with the MPN driver mutation and each other. JAK2-mutatedMPN patients with no concomitant mutations were younger than JAK2-mutated patients with TET2 or ASXL1 mutations. In contrast, age distributions were similar between JAK2-only patients and those with JAK2 and DNMT3A mutations (Fig 1A). This observation held when looking within PV and ET, and whether patients with single or multiple concomitant mutations were considered. Since DNMT3A, TET2 and ASXL1 clonal hematopoiesis is associated with increasing age, the similar age distribution of JAK2-only and JAK2-DNMT3A co-mutant patients was an unexpected finding, and worthy of further study. We evaluated the fraction of JAK2-mutated patients with a given concomitant mutation as a function of age. The fraction of patients with TET2 and ASXL1 mutations increased with age, but not the fraction of patients with DNMT3A mutations (95% CI of slope: 4e-3 to 7e-3 for TET2, 0 to 3e-3 for DNMT3A). Similarly, when we evaluated the fraction of JAK2-mutated patients with a given concomitant mutation as a function of JAK2 VAF, the fraction of patients with TET2 and ASXL1 mutations increased as JAK2 VAF increased, but the fraction of patients with DNMT3A mutations decreased (Fig 1B; 95% CI of slope: 1e-3 to 3e-3 for TET2, -2e-3 to 0 for DNMT3A). One potential explanation for this is that JAK2 and DNMT3A mutations occur as independent clonal acquisitions and that the JAK2-mutant clone “out-competes” the DNMT3A-mutant clone over time. At JAK2 VAFs of 50% and 100%, the ratio of TET2:JAK2 VAFs clustered at 1.0 and 0.5, suggesting frequent presence of a dominant JAK2-TET2 clone in all cells with heterozygous or homozygous JAK2 mutations. ASXL1 mutations occurred mostly in patients with JAK2 VAF &amp;gt; 50%, consistent with it being a subclonal acquisition. In contrast, DNMT3A concomitant mutations were more likely to occur in patients with JAK2 VAF&amp;lt;50% vs &amp;gt;50%, again suggesting that DNMT3A clones diminish as JAK2 clones expand. 6/45 DNMT3A mutations that occurred as the sole concomitant mutation were R882 hotspot mutations. However, DNMT3A was more likely to co-occur at JAK2 VAF&amp;gt;50% in patients with &amp;gt;1 concomitant mutation (most commonly TET2). This suggests that in the context of JAK2-mutant driven MPNs, DNMT3A subclones may require the presence of an additional mutation to expand. In summary, we found DNMT3A mutations behave differently from TET2 and ASXL1 mutations in JAK2-mutant MPNs. Patients with JAK2-mutant MPN are less likely to have DNMT3A mutations as JAK2 VAF increases. Compared with TET2 or ASXL1, DNMT3A appears more likely to exist as an independent clone in JAK2-mutant MPN, with our data suggesting the JAK2-mutant clone exhibits increased fitness compared to the DNMT3A-mutantclone over time. However, DNMT3A mutations persist when accompanied by other concomitant mutations (particularly TET2). These results raise interesting questions regarding clonal competition in MPN. Since all our analyses were performed from single clinical NGS panels, our findings require additional validation, including with multi-gene single-cell genotyping, which we are currently pursuing.

A c- MPL Splice Variant up-Regulated in Myeloproliferative Neoplasms Modulates Thrombopoietin Signaling and Induces Cycling of Hematopoietic Stem Cells and Inflammatory Progenitors

Introduction: Myeloproliferative neoplasms (MPN) are clonal disorders caused by mutations that activate JAK/STAT signaling through the thrombopoietin receptor, MPL, leading to overproduction of myeloid lineages. MPL is the only hematopoietic growth factor receptor expressed on the surface of hematopoietic stem cells (HSC) where it maintains their quiescence by tethering HSCs to osteoblasts in the endosteal niche. MPL is also expressed on megakaryocytes and platelets. Individuals born with loss of function mutations in the distal MPL cytokine receptor homology domain (CRHD) develop thrombocytopenia and progressive bone marrow failure. How MPL functions in MPN remains unclear. Here, we describe a novel MPL splice variant ( MPL-SV) that is present in CD34 + cells and platelets from healthy controls, but overexpressed in the MPN. We therefore sought to: 1) define MPL-SV function in hematopoiesis and MPN, and, 2) elucidate mechanisms underlying MPL-SV. Methods: After identifying a novel MPL-SV transcript from JAK2 V617F MPNplatelets, we compared its expression to MPL transcripts lacking the deletion in MPN patients and healthy controls. To assess its function, we generated transgenic (Tg) mice expressing varied levels of MPL-SV in HSC. Next, we examined responses of the Tg mice to thrombopoietin (THPO), hematopoietic stem progenitor cell (HSPC) frequency by flow cytometry, and HSPC function by colony-forming assays (CFA). To elucidate mechanisms, we performed single cell RNA sequencing (scRNAseq) of bone marrow (BM)-derived Lin -, Sca +, c-kit + (LSK) cells followed by pathway analysis. Results: Using primers to amplify the MPL CRHD in platelets from patients with JAK2 V617F MPN, we discovered an MPL- SV lacking 7 amino acids in the MPL amino-terminal domain, a common hotspot for activating MPN mutations. MPL-SV is present in CD34 + cells and platelets of healthy controls, but overexpressed in MPN relative to MPL transcripts lacking the deletion. To examine its function, we generated transgenic (Tg) mice expressing MPL-SV in HSC. Tg miceexpressing a single copy of MPL-SV have unperturbed hematopoiesis, whereas Tg mice expressing 6 copies of the transgene ( MPL-SV-6) develop marked thrombocytopenia, mild splenomegaly, and a modest increase in red cells by 9-12 weeks of age. Baseline serum THPO levels are elevated in Tg MPL-SV-6 mice and they fail to increase platelet counts following exogenous THPO administration, suggesting defective function of MPL-SV in binding and/or internalizing THPO. To further assess MPL-SV function, we compared CFA from HSPC of Tg MPL-SV-6 and wildtype mice, which show a decrease in total colony forming units (CFU) from BM or spleen-derived MPL-SV-6 HSPC. Accordingly, there was a decrease in LSK cells, multi-potent progenitors (MPPs), and megakaryocytes (Mk) in BM by flow cytometry. By contrast, spleens show increases in LK cells and short-term HSC. Further analysis by scRNAseq of BM-derived LSK cells reveal a marked decrease in both quiescent HSC and HSC with a Mk-bias associated with a relative expansion in more proliferative HSC, including those with a bias towards erythroid and mature myeloid differentiation. Pathway analysis reveal that MPL-SV activates transcriptional networks involved in TNF-α signaling via NF-κB and oxidative phosphorylation. Analysis of cell-cell interactions by CellChat show decreased signaling through intercellular adhesion molecule 1 (ICAM-1) in MPL-SV-6 HSC compared to controls. Importantly, ICAM1 maintains quiescent HSC within their BM niche. Similarly, cell cycle analysis from scRNAseq indicate that quiescent HSC are stimulated to cycle and generate HSC primed to differentiate into erythroid and myeloid progeny. Conclusions: We discovered a novel MPL-SV that is up-regulated in MPN. In Tg mice, MPL-SV impairs responses to THPO and disrupts hematopoiesis by depleting quiescent HSC and BM megakaryocytes. Single cell transcriptomics suggest that MPL-SV drives expansion of cycling HSC and HSC primed to differentiate into progenitors involved in inflammation, including myeloid cells. Mechanistically, HSPC expressing MPL-SV-6 activate transcriptional networks involved in TNFα signaling via NF-κB pathways. Our results highlight the central role for MPL in hematopoiesis and suggest that aberrant MPL splicing contributes to MPN pathogenesis.

SRSF2 mutation reduces polycythemia and impairs hematopoietic progenitor functions in JAK2V617F-driven myeloproliferative neoplasm

SRSF2 mutations are found in association with JAK2V617F in myeloproliferative neoplasms (MPN), most frequently in myelofibrosis (MF). However, the contribution of SRSF2 mutation in JAK2V617F-driven MPN remains elusive. To investigate the consequences of SRSF2P95H and JAK2V617F mutations in MPN, we generated Cre-inducible Srsf2P95H/+Jak2V617F/+ knock-in mice. We show that co-expression of Srsf2P95H mutant reduced red blood cell, neutrophil, and platelet counts, attenuated splenomegaly but did not induce bone marrow fibrosis in Jak2V617F/+ mice. Furthermore, co-expression of Srsf2P95H diminished the competitiveness of Jak2V617F mutant hematopoietic stem/progenitor cells. We found that Srsf2P95H mutant reduced the TGF-β levels but increased the expression of S100A8 and S100A9 in Jak2V617F/+ mice. Furthermore, enforced expression of S100A9 in Jak2V617F/+ mice bone marrow significantly reduced the red blood cell, hemoglobin, and hematocrit levels. Overall, these data suggest that concurrent expression of Srsf2P95H and Jak2V617F mutants reduces erythropoiesis but does not promote the development of bone marrow fibrosis in mice.

[Clinical and laboratory features of SF3B1-mutated myeloproliferative neoplasms].

Objective: To explore the clinical and laboratory characteristics of SF3B1 gene mutations in myeloproliferative neoplasms (MPN) patients. Methods: The clinical data of 273 MPN patients who were diagnosed MPN and treated in the Second Hospital of Tianjin Medical University from November 2017 to March 2023 were retrospectively analyzed. There were 133 males and 140 females, with a median age M(Q1,Q3)of 56(46, 67) years. The molecular biology and cytogenetic characteristics were detected by second-generation sequencing (NGS) and R+G banding techniques, and the clinical and laboratory characteristics of patients with SF3B1 gene mutation were analyzed. Results: SF3B1 gene mutations were found in 13 patients (4.8%, 13/273).The types of SF3B1 mutations included missense (92.3%, 12/13) and nonsense mutations (7.7%, 1/13).Compared to the non-mutant cohort, patients in SF3B1 mutant cohort had older ages [68(51, 76) vs 56(45, 66)years,P=0.025], higher proportion of splenomegaly [46.2%(6/13) vs 15.8%(41/259),P=0.014]and secondary tumor [23.1%(3/13)vs 3.8%(10/260), P=0.018]with higher proportion of bone marrow blast [0.5%(0, 1.5%) vs 0(0, 0.5%),P=0.002] and lower hemoglobin[(104±36) vs (137±40) g/L,P=0.004] and hematocrit [31%(22%, 40%) vs 41%(35%, 52%),P=0.003]. All of the 10 patients in the SF3B1 mutant cohort whose ring sideroblast (RS) could be evaluated showed no RS formation. The overall survival, thrombosis-free survival and leukemia free survival of MPN patients in SF3B1 mutant cohort were 4.0 (2.0, 6.0), 2.0 (0.5, 4.5) and 4.0 (2.0, 6.0) years, respectively, while patients in the non-mutant cohort were 6.0 (3.0, 10.0), 5.0 (1.0, 8.0), 6.0 (3.0, 10.0) years, respectively, there were no statistical significance between two groups (Z=3.69, 1.66, 2.05, all P>0.05).The secondary tumor free survival of SF3B1 mutant cohort patients was 4.0 (2.0, 6.0) years, which was lower than that of non-mutant cohort patients [5.5 (3.0, 10.0) years, Z=18.18, P<0.001). Conclusions: MPN patients with SF3B1 gene mutations are older, more prone to splenomegaly and secondary tumors. They also have a higher proportion of bone marrow blast, lower hemoglobin and hematocrit, and show no RS formation.

Antibody targeting of mutant calreticulin in myeloproliferative neoplasms.

Mutations in calreticulin are one of the key disease-initiating mutations in myeloproliferative neoplasms (MPN). In MPN, mutant calreticulin translates with a novel C-terminus that leads to aberrant binding to the extracellular domain of the thrombopoietin receptor, MPL. This cell surface neoantigen has become an attractive target for immunological intervention. Here, we summarize recent advances in the development of mutant calreticulin targeting antibodies as a novel therapeutic approach in MPN.

Additional Genetic Alterations and Clonal Evolution of MPNs with Double Mutations on the MPL Gene: Two Case Reports

Essential thrombocythemia (ET) and primary myelofibrosis (PMF) are two of the main BCR-ABL1-negative chronic myeloproliferative neoplasms (MPNs) characterized by abnormal megakaryocytic proliferation. Janus kinase 2 (JAK2) mutations are detected in 50–60% of ET and PMF, while myeloproliferative leukemia (MPL) virus oncogene mutations are present in 3–5% of cases. While Sanger sequencing is a valuable diagnostic tool to discriminate the most common MPN mutations, next-generation sequencing (NGS) is a more sensitive technology that also identifies concurrent genetic alterations. In this report, we describe two MPN patients with simultaneous double MPL mutations: a woman with ET presenting both MPLV501A-W515R and JAK2V617F mutations and a man with PMF displaying an uncommon double MPLV501A-W515L. Using colony-forming assays and NGS analyses, we define the origin and mutational landscape of these two unusual malignancies and uncover further gene alterations that may contribute to the pathogenesis of ET and PMF.

Germline JAK2 E846D Substitution as the Cause of Erythrocytosis?

The discovery in 2005 of the JAK2 V617F gain-of-function mutation in myeloproliferative neoplasms and more particularly in polycythemia vera has deeply changed the diagnostic and therapeutic approaches to polycythemia. More recently, the use of NGS in routine practice has revealed a large number of variants, although it is not always possible to classify them as pathogenic. This is notably the case for the JAK2 E846D variant for which for which questions remain unanswered. In a large French national cohort of 650 patients with well-characterized erythrocytosis, an isolated germline heterozygous JAK2 E846D substitution was observed in only two cases. For one of the patients, a family study could be performed, without segregation of the variant with the erythrocytosis phenotype. On the other hand, based on the large UK Biobank resource cohort including more than half a million UK participants, the JAK2 E846D variant was found in 760 individuals, associated with a moderate increase in hemoglobin and hematocrit values, but with no significant difference to the mean values of the rest of the studied population. Altogether, our data as well as UK Biobank cohort analyses suggest that the occurrence of an absolute polycythemia cannot be attributed to the sole demonstration of an isolated JAK2 E846D variant. However, it must be accompanied by other stimuli or favoring factors in order to generate absolute erythrocytosis.

Abstract LB256: Type 1 calreticulin mutations in myeloproliferative neoplasms promote glycolysis via intracellular calcium mediated upregulation of GLUT1

Abstract Myeloproliferative neoplasms (MPNs) comprise a group of cancers of the bone marrow that can transform into a post-MPN acute myeloid leukemia (AML), at which point the overall survival rate is less than 6 months. JAK2 inhibitors in MPN failed to alter disease progression, emphasizing the need for new treatments. Calreticulin (CALR) is one of the MPN driver mutations and encodes an endoplasmic reticulum (ER) calcium (Ca2+) binding protein. CALR mutations are classified as either type 1 or type 2. Only type 1 proteins exhibit loss of the C-terminal Ca2+ binding sites. Additionally, type 1 and 2 CALR mutations engender significant prognostic differences. Previously published work from our lab showed that type 1 CALR exhibits a loss of Ca2+ binding sites, rendering them unable to bind ER Ca2+ and leading to depletion of ER Ca2+ stores. We next wanted to evaluate where this Ca2+ is localized. Through imaging studies, we found that CALR type 1 expressing cells have significantly increased cytosolic Ca2+ and significantly lower mitochondrial Ca2+ compared to both CALR wildtype and CALR type 2 expressing cells. It has been well established in various cancer types that increased glycolytic activity is prompted in part by elevated cytosolic Ca2+. To test if this was the case in our model, we performed a vast array of metabolic assays in UT-7-MPL cells, a human megakaryocytic cell line, including but not limited to lactate secretion, Seahorse XF Glycolysis Stress Test assay, and metabolite tracing with 13-C labelled glucose. These all confirmed a highly glycolytic profile in UT-7-MPL cells expressing the CALR type 1 mutation. In addition, through evaluation of mitochondrial mass, membrane potential and several other assays, mitochondrial metabolism in CALR type 1 mutant cells appears severely dysfunctional. All the glycolytic and mitochondrial phenotypes are almost fully rescued upon the reintroduction of the Ca2+ binding sites of the CALRwt protein (P and C domains; P+C), indicating that perturbed Ca2+ homeostasis is the driver of these changes. Pharmacological treatment with cytosolic Ca2+ chelator BAPTA-AM or with kaempferol, an activator of the mitochondrial Ca2+ uniporter mimic the P+C rescue effect for both the glycolytic and the mitochondrial phenotypes. In our in vitro system CALR type 1 mutant cells express along with other glycolytic factors significantly higher cell surface levels of the glucose transporter GLUT1, and demonstrate enhanced sensitivity to pharmacological GLUT1 inhibition with BAY-876. Preliminary data in a transgenic mouse model as well as in primary patient samples show that GLUT1 expression is higher in CALR type 1 mutant mice and patient cells, and that the mitochondrial mass in this subset of patients is lower compared to CALR type 2 mutant patients. Finally, we validated that all these phenotypes are JAK/STAT pathway independent and that they are worsened by ruxolitinib treatment, providing a strong rationale for a combination treatment. Together, these data both expand the current knowledge of the role that Ca2+ dynamics play in metabolic reprogramming and can lead to improved targeted therapies for MPN patients. Citation Format: Michele Ciboddo, Jonathan Dowgielewicz, George Yan, Deborah Rodriguez, Hunter Blaylock, Nicole Arellano, Chad Coen, Chufan Cai, Nia Hammond, Alex Rosencrance, Elisa Rumi, Daniela Pietra, Daniele Vanni, Silvia Catricalà, Ilaria Carola Casetti, Oscar Borsani, Brandon Faubert, Shannon Elf. Type 1 calreticulin mutations in myeloproliferative neoplasms promote glycolysis via intracellular calcium mediated upregulation of GLUT1 [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2023; Part 2 (Clinical Trials and Late-Breaking Research); 2023 Apr 14-19; Orlando, FL. Philadelphia (PA): AACR; Cancer Res 2023;83(8_Suppl):Abstract nr LB256.

A customized mass array panel for BCR::ABL1 tyrosine kinase domain mutation screening in chronic myeloid leukemia

IntroductionThe therapeutic strategy and management of chronic myeloid leukemia (CML) have rapidly improved with the discovery of effective tyrosine kinase inhibitors (TKIs) to target BCR::ABL1 oncoprotein. However, nearly 30% of patients develop TKI resistance due to acquired mutations on the tyrosine kinase domain (TKD) of BCR::ABL1. MethodsWe customized a mass array panel initially intended to detect and monitor the mutational burden of hotspot BCR::ABL1 TKD mutations accumulated in our database, including key mutations recently recommended by European LeukemiaNet. Additionally, we extended the feasibility of using the assay panel for the molecular classification of myeloproliferative neoplasms (MPNs) by incorporating primer sets specific for analyzing JAK2 V617F, MPL 515 K/L, and CALR types 1 and 2. ResultsWe found that the developed mass array panel was superior for detecting and monitoring clinically significant BCR::ABL1 TKD mutations, especially in cases with low mutational burden and harboring compound/polyclonal mutations, compared with direct sequencing. Moreover, our customized mass array panel detected common genetic alterations in MPNs, and the findings were consistent with those of other comparable assays available in our laboratory. ConclusionsOur customized mass array panel was practicably used as a routine robust assay for screening and monitoring BCR::ABL1 TKD mutations in patients with CML undergoing TKI treatment and feasible for analyzing common genetic mutations in MPNs.

Establishment of isogenic induced pluripotent stem cells with or without pathogenic mutation for understanding the pathogenesis of myeloproliferative neoplasms

Identification and functional characterization of disease-associated genetic traits are crucial for understanding the pathogenesis of hematologic malignancies. Various in vitro and in vivo models, including cell lines, primary cells, and animal models, have been established to examine these genetic alterations. However, their nonphysiologic conditions, diverse genetic backgrounds, and species-specific differences often limit data interpretation. To evaluate somatic mutations in myeloproliferative neoplasms (MPNs), we used CRISPR/Cas9 combined with the piggyBac transposon system to establish isogenic induced pluripotent stem (iPS) cell lines with or without JAK2V617F mutation, a driver mutation of MPNs. We induced hematopoietic stem/progenitor cells (HSPCs) from these iPS cells and observed phenotypic differences during hematopoiesis using fluorescence-activated cell sorting analysis. HSPCs with pathogenic mutations exhibited cell-autonomous erythropoiesis and megakaryopoiesis, which are hallmarks in the bone marrow of patients with MPNs. Furthermore, we used these HSPCs as a model to validate therapeutic compounds and showed that interferon alpha selectively inhibited erythropoiesis and megakaryopoiesis in mutant HSPCs. These results demonstrate that genome editing is feasible for establishing isogenic iPS cells, studying genetic elements to understand the pathogenesis of MPNs, and evaluating therapeutic compounds against MPNs.

Dual Targeting of HDM2 and PPM1D As a Novel Therapeutic Approach for Myelofibrosis

Dysregulation of TP53 in myeloproliferative neoplasms (MPNs) has been hypothesized to be a key driver of disease progression (Kubesova et al, Leukemia. 2018;32 (2):450-61). Targeting of double minute protein 2 (HDM2), a negative regulator of TP53, results in activation of the TP53 pathway which induces cell death in hematopoietic stem and progenitor cells (HSPCs). Nutlins, antagonists of HDM2, are currently being evaluated in multiple MPN clinical trials with promising results to date. Protein Phosphatase Mg2+/Mn2+ dependent 1D protein (PPM1D) is another key negative regulator of the TP53 pathway that dephosphorylates TP53 and stabilizes HDM2 (Hsu et al. Cell Stem Cell. 2018 Nov 1;23(5):700-13). We and others have previously reported the presence of PPM1D mutations in MPNs that result in overexpression of the protein (Grinfeld et al, N Engl J Med. 2018 Oct 11;379 (15):1416-30). We have also reported overexpression of PPM1D in the mononuclear cells (MNC) of a subset of MPN patients not harboring PPM1D mutations. We hypothesize that inhibition of PPM1D in myelofibrosis (MF) would target the MF HSPC and sensitize MF HSPCs to HDM2 inhibitors resulting in further depletion of MF HSPCs. To further characterize PPM1D expression in the MF HSPC compartment, we utilized quantitative real time-PCR, to assess PPM1D transcript levels in CD34+ cells from 28 MF patients and compared these transcript levels to levels in CD34+ normal control cells (n=6). Forty-three percent (12/28) of the MF samples had overexpression of PPM1D (>1.5 fold increase) and the fold increase ranged from 1.8-59. To identify whether PPM1D is a viable therapeutic target for MF HSPCs, we utilized hematopoietic colony assays to test the activity of GSK2830371, an allosteric inhibitor of PPM1D (PPM1Di) alone and in combination with a low dose HDM2 inhibitor (HDM2i). Eight samples from distinct MF patients were tested under these conditions. There was not a significant reduction in the number of JAK2V617F+ colonies upon treatment with single agent HDM2i (50 nM) (p>0.05) or PPM1Di (1uM) (p>0.05). Combination of PPM1Di (1 uM) + HDM2i (50 nM) resulted in decreased JAK2V617F+ colony formation in all 8 samples (p<0.005) (Fig. 1). The reduction in JAK2V617F+ colony number was significant compared to either single agent treatment with HDM2i (p<0.001) or PPM1Di (p<0.05) (Fig. 1). Four samples had persistence of or an increase in JAK2 wild-type (WT) colony number with combination treatment. The MF samples utilized were from a heterogenous population of patients that all had WT TP53 and PPM1D but included patients with high risk myeloid mutations (in ASXL1, NRAS), complex cytogenetics and prior exposure to standard MF directed therapies. Additionally, to validate the on-target effect of PPM1Di, we showed that treatment of leukemia cell lines with PPM1Di led to increased protein levels of phosphorylated-p53 and p21 and resulted in decreased viability and increased apoptosis. To determine the effect of PPM1Di +/- HDM2i on distinct subclones we employed a multi-omics approach that allows for single cell mutation and epitope analysis of a clonally complex patient sample. We analyzed MNCs from a JAK2V617F, NRASG12D, TET2T1884A, ASXL1W960* MF patient treated in suspension culture with PPM1Di (1uM) alone, low dose HDM2i (50 nM) alone and PPM1Di (1uM) + low dose HDM2i (50 nM) in combination. Compared to vehicle alone or either drug alone, a marked effect was seen with the combination approach whereby the percent of WT cells increased by nearly 5 fold (4% to 19%) and 4/6 mutated clones were decreased in size, demonstrated by the fishplot (Fig. 2). These results show that the combination of the HDM2i + PPM1Di depletes multiple MF clones, while allowing for the emergence of more WT cells. Furthermore these studies demonstrate the utility of single cell genotyping to evaluate the effects of novel therapeutic strategies on MF clonal architecture. These studies indicate that PPM1Di sensitizes MF HSPCs to an HDM2i and is a promising strategy to treat MF patients. To this purpose, we are currently developing a novel clinical grade PPM1D targeting agent. Dual targeting of PPM1D and HDM2 has the potential to further deplete multiple MF HSPC clones while allowing the persistence of WT cells. Additional combinatorial mutation + epitope studies are underway to determine degree of MF HSPC subpopulation depletion utilizing this treatment strategy. Figure 1View largeDownload PPTFigure 1View largeDownload PPT Close modal

Causes of Thrombocytosis: A Single-center Retrospective Study of 1,202 Patients.

Objective Thrombocytosis can occur as a primary event accompanying hematological diseases or as a secondary event. Since the publication of the World Health Organization classification in 2008, thrombocytosis is now generally defined as a platelet count above 450×109/L. Furthermore, the discovery of driver-gene mutations in myeloproliferative neoplasms (MPNs) has simplified the diagnostic approach for thrombocytosis. To identify the causes of thrombocytosis using this new definition, we conducted a retrospective study. Methods We identified outpatients and inpatients aged 20 years or older with platelet counts >450×109/L in a half-year period at a single institute and analyzed the causes of thrombocytosis and associated clinical characteristics. Results Among 1,202 patients with thrombocytosis, 150 (12.5%) had primary and 999 (83.1%) had secondary thrombocytosis. Of these patients with primary thrombocytosis, 129 (86%) had at least 1 molecular marker indicative of MPNs. The major causes of secondary thrombocytosis were tissue injury (32.2%), infection (17.1%), chronic inflammatory disorders (11.7%) and iron deficiency anemia (11.1%). The median platelet count and the incidence of thrombosis were significantly higher in patients with primary thrombocytosis than in those with secondary thrombocytosis. Conclusion Thrombocytosis mainly occurs as a secondary event; however, it is important to determine the cause of and prevent thrombosis, particularly in cases of primary thrombocytosis.

Modulation of the Human Thrombopoietin Receptor Conformation Uncouples JAK2 V617F-Driven from Cytokine-Induced Activation

Myeloproliferative Neoplasms are clonal diseases where mutations in hematopoietic stem cells (HSCs) result in cytokine-independent activation of the Thrombopoietin Receptor (TpoR) and aberrant proliferation and differentiation of HSCs and myeloid progenitors1. The most prevalent mutation, JAK2 V617F, is the basis of >95% of Polycythemia Vera (PV) and 60% of Essential Thrombocythemia (ET) and Myelofibrosis cases2. Current treatment strategies have focused on direct inhibition of JAK2 with little or no success and with poor specificity for the V617F mutant. Unlike JAK2, the TpoR is present at the cell surface and is more easily targetable. Using a system of controlled dimerization, we previously reported that different dimeric orientations of murine TpoR result in distinct signaling pathways and variable activation intensity3. Recently, others have demonstrated that extracellular ligands (diabodies) are able to modulate human TpoR conformation to influence downstream signaling4. Here, we investigated the possibility to modulate human TpoR conformation to specifically target JAK2 V617F driven activation while preserving natural cytokine-induced signaling. Using our system of controlled dimerization of TpoR transmembrane (TM) domain, we characterized the active and inactive conformation of human TpoR in presence of JAK2 WT or JAK2 V617F in hematopoietic cells. While murine TpoR is active in almost all (6 out of 7) dimeric conformations, only 3 conformations allowed activation of human TpoR. The discrepancy between murine and human TpoR is due to sequence differences in the TM domain that modulates dimerization. Remarkably, we discovered that different dimeric conformations mediate activation of JAK2 WT and JAK2 V617F in human but not in murine TpoR. Using a cysteine cross-linking assay on live cells, we validated that TpoR dimers exhibit a different conformation in presence of JAK2 V617F than this induced by the thrombopoietin (Tpo). Given the different dimeric conformations of TpoR induced by Tpo and JAK2 V617F, we hypothesize that modulation of TpoR conformation could allow specific inhibition of JAK2 V617F-driven activation while preserving Tpo-induced activation. We probed this by introducing a glycine zipper GxxxG motif to favor dimerization in a conformation that renders JAK2 V617F inactive but allows Tpo induced activation. Conversely, we mutated residues of the TM domain to specifically disrupt the conformation required for JAK2 V617F-mediated activation. Both strategies resulted in complete inactivation of JAK2-V617F driven activation of TpoR but preserved its full activation by Tpo and cell surface localization. Together, these results provide a first demonstration that modulation of TpoR dimeric conformation is a suitable strategy for specific inhibition of the JAK2 V617F-driven activation and opens the road for novel therapeutic avenues. 1. Vainchenker W, Kralovics R. Genetic basis and molecular pathophysiology of classical myeloproliferative neoplasms. Blood. 2017;129(6):667-679. 2. Constantinescu SN, Vainchenker W, Levy G, Papadopoulos N. Functional Consequences of Mutations in Myeloproliferative Neoplasms. Hemasphere. 2021;5(6):e578. 3. Staerk J, Defour JP, Pecquet C, et al. Orientation-specific signalling by thrombopoietin receptor dimers. Embo j. 2011;30(21):4398-4413. 4. Cui L, Moraga I, Lerbs T, et al. Tuning MPL signaling to influence hematopoietic stem cell differentiation and inhibit essential thrombocythemia progenitors. Proceedings of the National Academy of Sciences. 2021;118(2):e2017849118. Figure 1View largeDownload PPTFigure 1View largeDownload PPT Close modal

JAK Inhibition Mediates Clonal Selection of RAS Pathway Mutations in Myeloproliferative Neoplasms

JAK Inhibition Mediates Clonal Selection of RAS Pathway Mutations in Myeloproliferative Neoplasms

Effects of CALR-Mutant Type and Burden on the Phenotype of Myeloproliferative Neoplasms.

Somatic CALR mutations occur in approximately 70% of patients with JAK2 V617F-negative essential thrombocythemia (ET) and primary myelofibrosis (PMF). We evaluated the effects of the CALR mutant type and burden on the phenotype of CALR-mutated myeloproliferative neoplasms (MPN). Of the 510 patients with suspected or diagnosed MPN, all 49 patients detected with CALR mutations were diagnosed with ET (n = 32) or PMF (n = 17). The CALR mutant burden was significantly higher in PMF than in ET (45% vs. 34%), and type 1-like and type 2-like mutations were detected in 49% and 51% patients, respectively. Patients with MPN and type 2-like mutation showed a significantly higher median platelet count than those with type 1-like mutation. Particularly, patients with ET and type 2-like mutation had no thrombotic events, despite higher platelet counts. The effect of CALR mutant burden differed depending on the mutant type. A higher mutant burden tended to be associated with a cytopenic phenotype (i.e., lower hemoglobin levels and platelet counts) in patients with the type 1-like mutation and a proliferative hematological phenotype (i.e., higher platelet and neutrophil counts) in patients with the type 2-like mutation. This study suggests that the disease phenotype of MPN may be altered through CALR mutant burden and mutant type.